mebioda

High-throughput DNA sequencing

Data centric view of genome resequencing workflow

  1. (semi-)raw reads come out of lab as FASTQ
  2. reads are assembled to a FASTA file
  3. reads are aligned to a (pseudo-)reference as SAM/BAM/CRAM
  4. alignment is viewed in genome browser, with additional tracks as BED
  5. variants are called (e.g. as VCF/BCF), consensus is computed (e.g. as FASTA)
  6. consensus is annotated as GFF

The FASTA format

Extensions:

The FASTQ format

Record layout:

  1. @+identifier - note paired-end sequencing
  2. Sequence data - IUPAC single character nucleotides
  3. + - separator between sequence and quality
  4. Quality lines - map phred scores to ASCII characters

Example:

@FAKE0005
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACG
+
@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~

Quality (phred) scores

Phred quality scores Q are defined as a property which is logarithmically related to the base-calling error probabilities P.

Q = -10 log10 P

For example, if Phred assigns a quality score of 30 to a base, the chances that this base is called incorrectly are 1 in 1000.

Phred Quality Score Probability of incorrect base call Base call accuracy
10 1 in 10 90%
20 1 in 100 99%
30 1 in 1000 99.9%
40 1 in 10,000 99.99%
50 1 in 100,000 99.999%
60 1 in 1,000,000 99.9999%

Phred score encoding

Different platforms map phred scores in different ways to ASCII:

code char code char code char code char code char code char
33 ! 49 1 65 A 81 Q 97 a 113 q
34 ” 50 2 66 B 82 R 98 b 114 r
35 # 51 3 67 C 83 S 99 c 115 s
36 $ 52 4 68 D 84 T 100 d 116 t
37 % 53 5 69 E 85 U 101 e 117 u
38 & 54 6 70 F 86 V 102 f 118 v
39 ’ 55 7 71 G 87 W 103 g 119 w
40 ( 56 8 72 H 88 X 104 h 120 x
41 ) 57 9 73 I 89 Y 105 i 121 y
42 * 58 : 74 J 90 Z 106 j 122 z
43 + 59 ; 75 K 91 [ 107 k 123 {
44 , 60 < 76 L 92 \ 108 l 124 |
45 - 61 = 77 M 93 ] 109 m 125 }
46 . 62 > 78 N 94 ^ 110 n 126 ~
47 / 63 ? 79 O 95 _ 111 o    
48 0 64 @ 80 P 96 ` 112 p    

The SAM/BAM/CRAM format

Example alignment:

Coor    12345678901234  5678901234567890123456789012345
ref     AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT
+r001/1       TTAGATAAAGGATA*CTG                       
+r002        aaaAGATAA*GGATA
+r003      gcctaAGCTAA
+r004                    ATAGCT..............TCAGC
-r003                           ttagctTAGGC
-r001/2                                       CAGCGGCAT

SAM representation

Example:

@HD VN:1.5 SO:coordinate
@SQ SN:ref LN:45
r001    99 ref  7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r002     0 ref  9 30 3S6M1P1I4M * 0   0 AAAAGATAAGGATA    *
r003     0 ref  9 30 5S6M       * 0   0 GCCTAAGCTAA       *
r004     0 ref 16 30 6M14N5M    * 0   0 ATAGCTTCAGC       *
r003  2064 ref 29 17 6H5M       * 0   0 TAGGC             *
r001   147 ref 37 30 9M         = 7 -39 CAGCGGCAT         *

Mandatory columns:

No. Name Description
1 QNAME Query NAME of the read or the read pair
2 FLAG Bitwise FLAG (pairing, strand, mate strand, etc.)
3 RNAME Reference sequence NAME
4 POS 1-Based leftmost POSition of clipped alignment
5 MAPQ MAPping Quality (Phred-scaled)
6 CIGAR Extended CIGAR string (operations: MIDNSHP)
7 MRNM Mate Reference NaMe (‘=’ if same as RNAME)
8 MPOS 1-Based leftmost Mate POSition
9 ISIZE Inferred Insert SIZE
10 SEQ Query SEQuence on the same strand as the reference
11 QUAL Query QUALity (ASCII-33=Phred base quality)

What is a CIGAR?

The sequence being aligned to a reference may have additional bases that are not in the reference or may be missing bases that are in the reference. The CIGAR string is a sequence of base lengths and the associated operation. They are used to indicate things like which bases align (either a match/mismatch) with the reference, are deleted from the reference, and are insertions that are not in the reference. For example:

RefPos:     1  2  3  4  5  6  7  8  9 10 11 12 13 14 15 16 17 18 19
Reference:  C  C  A  T  A  C  T  G  A  A  C  T  G  A  C  T  A  A  C
Read: ACTAGAATGGCT

Aligning these two:

RefPos:     1  2  3  4  5  6  7     8  9 10 11 12 13 14 15 16 17 18 19
Reference:  C  C  A  T  A  C  T     G  A  A  C  T  G  A  C  T  A  A  C
Read:                   A  C  T  A  G  A  A     T  G  G  C  T

With the alignment above, you get:

POS: 5
CIGAR: 3M1I3M1D5M

The POS indicates that the read aligns starting at position 5 on the reference. The CIGAR says that the first 3 bases in the read sequence align with the reference. The next base in the read does not exist in the reference. Then 3 bases align with the reference. The next reference base does not exist in the read sequence, then 5 more bases align with the reference. Note that at position 14, the base in the read is different than the reference, but it still counts as an M since it aligns to that position.

Bitwise flags

2x Value (Hex) Value (Decimal) Bits SAM property
20 1 1 000000000001 are there multiple fragments?
21 2 2 000000000010 are all fragments properly aligned?
22 4 4 000000000100 is this fragment unmapped?
23 8 8 000000001000 is the next fragment unmapped?
24 10hex 16 000000010000 is this query the reverse strand?
25 20hex 32 000000100000 is the next fragment the reverse strand?
26 40hex 64 000001000000 is this the 1st fragment?
27 80hex 128 000010000000 is this the last fragment?
28 100hex 256 000100000000 is this a secondary alignment?
29 200hex 512 001000000000 did this read fail quality controls?
2A 400hex 1024 010000000000 is this read a PCR or optical duplicate?
2B 800hex 2048 100000000000 supplementary alignment

The values in the FLAG column (2) correspond to bitwise flags as follows:

FLAG hex Explanation
99 0x63 first/next is reverse-complemented/properly aligned/multiple segments
0   no flags set, thus a mapped single segment
2064 0x810 supplementary/reversecomplemented
147 0x93 last (second of a pair)/reverse-complemented/properly aligned/multiple segments

Using the flags, we can filter the reads in a BAM file using samtools:

$ samtools view -f 4 file.bam > unmapped.sam

The BED format

If you load a SAM/BAM file in a genome browser (e.g. UCSC) you might want to load additional ‘tracks’ alongside the alignment. For this the BED format is used.

track name=pairedReads description="Clone Paired Reads" useScore=1
chr22 1000 5000 cloneA 960 + 1000 5000 0 2 567,488, 0,3512
chr22 2000 6000 cloneB 900 - 2000 6000 0 2 433,399, 0,3601
  1. The name of the chromosome (e.g. chr3, chrY, chr2_random) or scaffold (e.g. scaffold10671).
  2. The starting position of the feature in the chromosome or scaffold. The first base in a chromosome is numbered 0.
  3. The ending position of the feature in the chromosome or scaffold. The chromEnd base is not included in the display of the feature. For example, the first 100 bases of a chromosome are defined as chromStart=0, chromEnd=100, and span the bases numbered 0-99.
  4. Defines the name of the BED line. This label is displayed to the left of the BED line in the Genome Browser window when the track is open to full display mode or directly to the left of the item in pack mode.
  5. A score between 0 and 1000. If the track line useScore attribute is set to 1 for this annotation data set, the score value will determine the level of gray in which this feature is displayed (higher numbers = darker gray).
  6. Defines the strand. Either “.” (=no strand) or “+” or “-“.
  7. The starting position at which the feature is drawn thickly (for example, the start codon in gene displays). When there is no thick part, thickStart and thickEnd are usually set to the chromStart position.
  8. The ending position at which the feature is drawn thickly (for example the stop codon in gene displays).
  9. An RGB value of the form R,G,B (e.g. 255,0,0). If the track line itemRgb attribute is set to “On”, this RBG value will determine the display color of the data contained in this BED line. NOTE: It is recommended that a simple color scheme (eight colors or less) be used with this attribute to avoid overwhelming the color resources of the genome Browser and your Internet browser.
  10. The number of blocks (exons) in the BED line.
  11. A comma-separated list of the block sizes. The number of items in this list should correspond to blockCount.
  12. A comma-separated list of block starts. All of the blockStart positions should be calculated relative to chromStart. The number of items in this list should correspond to blockCount.

The VCF/BCF format

##fileformat=VCFv4.2
##fileDate=20090805
##source=myImputationProgramV3.1
##reference=file:///seq/references/1000GenomesPilot-NCBI36.fasta
##contig=<ID=20,length=62435964,assembly=B36,md5=f126cdf8a6e0c7f379d618ff66beb2da,species="Homo sapiens",taxonomy=x>
##phasing=partial
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency">
##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129">
##INFO=<ID=H2,Number=0,Type=Flag,Description="HapMap2 membership">
##FILTER=<ID=q10,Description="Quality below 10">
##FILTER=<ID=s50,Description="Less than 50% of samples have data">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality">
#CHROM  POS     ID          REF ALT     QUAL    FILTER  INFO                                FORMAT      NA00001         NA00002         NA00003
20      14370   rs6054257   G   A       29      PASS    NS=3;DP=14;AF=0.5;DB;H2             GT:GQ:DP:HQ 0|0:48:1:51,51  1|0:48:8:51,51  1/1:43:5:.,.
20      17330   .           T   A       3       q10     NS=3;DP=11;AF=0.017                 GT:GQ:DP:HQ 0|0:49:3:58,50  0|1:3:5:65,3    0/0:41:3
20      1110696 rs6040355   A   G,T     67      PASS    NS=2;DP=10;AF=0.333,0.667;AA=T;DB   GT:GQ:DP:HQ 1|2:21:6:23,27  2|1:2:0:18,2    2/2:35:4
20      1230237 .           T   .       47      PASS    NS=3;DP=13;AA=T                     GT:GQ:DP:HQ 0|0:54:7:56,60  0|0:48:4:51,51  0/0:61:2
20      1234567 microsat1   GTC G,GTCT  50      PASS    NS=3;DP=9;AA=G                      GT:GQ:DP    0/1:35:4        0/2:17:2        1/1:40:3
  1. a good simple SNP
  2. a possible SNP that has been filtered out because its quality is below 10
  3. a site at which two alternate alleles are called, with one of them (T) being ancestral (possibly a reference sequencing error)
  4. a site that is called monomorphic reference (i.e. with no alternate alleles)
  5. a microsatellite with two alternative alleles, one a deletion of 2 bases (TC), and the other an insertion of one base (T).

Genotype data are given for three samples, two of which are phased and the third unphased, with per sample genotype quality, depth and haplotype qualities (the latter only for the phased samples) given as well as the genotypes. The microsatellite calls are unphased.

The GFF format

Once a plausible sequence has been generated (e.g. by doing a de novo assembly or by computing a consensus from a genome alignment) the next step might be to annotate it, i.e. predict ORFs and scan databases for homologies. Such genome annotations are stored in GFF files:

contig_1    maker   gene            1797    7025    .   +   .   ID=CR513_016834;Name=CR513_016834;Alias=maker-contig_1-snap-gene-0.0;Note=Similar to SCAI: Protein SCAI (Homo sapiens);
contig_1    maker   five_prime_UTR  1797    1954    .   +   .   ID=CR513_016834-RA:five_prime_utr;Parent=CR513_016834-RA;
contig_1    maker   CDS             1955    2095    .   +   0   ID=CR513_016834-RA:cds;Parent=CR513_016834-RA;
contig_1    maker   CDS             2223    2359    .   +   0   ID=CR513_016834-RA:cds;Parent=CR513_016834-RA;
contig_1    maker   CDS             6748    6979    .   +   1   ID=CR513_016834-RA:cds;Parent=CR513_016834-RA;
contig_1    maker   three_prime_UTR 6980    7025    .   +   .   ID=CR513_016834-RA:three_prime_utr;Parent=CR513_016834-RA;
  1. name of the chromosome or scaffold; chromosome names can be given with or without the ‘chr’ prefix. Important note: the seqname must be one used within Ensembl, i.e. a standard chromosome name or an Ensembl identifier such as a scaffold ID, without any additional content such as species or assembly. See the example GFF output below.
  2. name of the program that generated this feature, or the data source (database or project name)
  3. feature type name, e.g. Gene, Variation, Similarity
  4. start position of the feature, with sequence numbering starting at 1.
  5. end position of the feature, with sequence numbering starting at 1.
  6. a floating point value.
  7. defined as + (forward) or - (reverse).
  8. one of ‘0’, ‘1’ or ‘2’. ‘0’ indicates that the first base of the feature is the first base of a codon, ‘1’ that the second base is the first base of a codon, and so on.
  9. semicolon-separated list of tag-value pairs, providing additional information about each feature.

Submission to NCBI

See: WGS2NCBI

This site is open source. Improve this page.